circad | circRNAs associated with diseases

hsa_circ_0001971
Gene	FAM126A	Organism	Human
Genome Locus	chr7:23015828-23023664:-	Build	hg19
Disease	Oral Squamous Cell Carcinoma	ICD-10	Carcinoma in situ of oral cavity, oesophagus and stomach (D00)
DBLink	Link to database	PMID	29991057
Experimental Method
Sample Type	Tissues	Comparison	3 OSCC patients and 3 age- and sex-matched healthy controls
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GCTGCCTTAACTTACATGCCC Reverse ACTTTGTGGCTCCTGGATAACT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Zhao, SY, Wang, J, Ouyang, SB, Huang, ZK, Liao, L (2018). Salivary Circular RNAs Hsa_Circ_0001874 and Hsa_Circ_0001971 as Novel Biomarkers for the Diagnosis of Oral Squamous Cell Carcinoma. Cell. Physiol. Biochem., 47, 6:2511-2521.